From: owner-sc-users-digest@lists.io.com (sc-users-digest) To: sc-users-digest@lists.io.com Subject: sc-users-digest V1 #316 Reply-To: sc-users Sender: owner-sc-users-digest@lists.io.com Errors-To: owner-sc-users-digest@lists.io.com Precedence: bulk sc-users-digest Wednesday, July 4 2001 Volume 01 : Number 316 ---------------------------------------------------------------------- Date: Mon, 02 Jul 2001 23:44:54 -0700 From: ben <---@---.---> Subject: Re: About copying code (printing strings) er i knew i should have looked at it again: ( newarray = Array.fill(howManyPbinds, {arg i; Pbind(\freq, freqs.at(i)) }); Synth.play({ Ppar(newarray).asSpawn )} ); you knew what i meant, right? b - -- ben milstein mintyfresh www.soundmangle.com - www.elmconceptions.com > From: ben <---@---.---> > Reply-To: sc-users@lists.io.com > Date: Mon, 02 Jul 2001 23:29:11 -0700 > To: > Subject: Re: About copying code (printing strings) > > hi > simpler way perhaps: > > ( > newarray = Array.fill(howManyPbinds, {arg i; Pbind(\freq, freqs.at(i)) }); > > Synth.play({ > newarray = Ppar(newarray).asSpawn > )} > ); > > cheers! > ben (in london and loving it ;) > > -- > ben milstein > mintyfresh > www.soundmangle.com - www.elmconceptions.com > >> From: Julian Rohrhuber <---@---.---> >> Reply-To: sc-users@lists.io.com >> Date: Sun, 1 Jul 2001 19:41:03 +0200 >> To: sc-users@lists.io.com >> Subject: Re: About copying code (printing strings) >> >>> Thank you for answering. >>> >>> It is true! it is more logic to copy the Pbind itself but I didn't want to >>> do that because in that Pbind is a message such as .at(0) >>> which needs to be increased for each new Pbind of the new array, >>> so I thought it wouldn't work... >>> >>> >>> If my original is: >>> Pbind(\freq, freqs.at(0)) >>> I want to get: >>> newarray = [ Pbind(\freq, freqs.at(0)), Pbind(\freq, freqs.at(1))]; >>> when a.size = 2; >>> >>> >>> Could I do this? >>> newarray = Array.fill(a.size, {arg i; Pbind(\freq, freqs.at(0)) }); >>> >>> And then call my different Pbinds like this? >>> ( >>> Synth.play({ >>> newarray.at(0) + newarray.at(1) newarray.at(2); >>> }) >>> ) >>> Fabrice >>> end >> >> >> I guess you mean this: >> newarray = Array.fill(a.size, {arg i; Pbind(\freq, freqs.at(i)) }); >> >> you have to convert your Pbinds into UGens first, >> then you can simply mix them: >> ( >> Synth.play({ >> newarray = newarray.collect({ arg item; item.asSpawn(2, >> event.protoEvent) }); >> //or for sc3: newarray.collect({ arg item; item.ar(2) }) >> Mix.ar(newarray) >> >> >> }) >> ) >> > > ------------------------------ Date: Tue, 3 Jul 2001 00:46:46 +0200 From: Arie van Schutterhoef <---@---.---> Subject: Re: CPU (related to scope) >my live patch frequently peaks between 80 and 200 % (yes 200) with no >problems whatsoever. ??? doesnt make sense to me but it works quite >smoothly... - -For a short amount of time SC seems to tolerate such shifts. Guess garbage collection plays a role in this. I have had during experimenting peaks to 300%, at which SC started to 'complain'; a bit like dropping frames in video. I wouldn't recommend doing this at concerts at a sustained rate. >is ram allocation related to cpu load? - -Depends what you doing: soundfiles usage will benefit from ram. AvS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .................................................................. ^ Arie van Schutterhoef | arsche@xs4all.nl ^_北北北北北北北北北北北盻_""""""""""""""""""""""""""""""""" | ` |Schreck Ensemble http://www.xs4all.nl/~schreck/ | ` |# -laboratory for live electro-acoustic music- # | ` |Tel: 00-31-71-5612287 Fax: 00-31-70-3859268 | *========================================================++ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .................................................................. ------------------------------ Date: Mon, 02 Jul 2001 18:49:42 -0400 From: christian adam hresko <---@---.---> Subject: Re: no summer class? mac expo NYC tomonori yamasaki wrote: > So there's no CNMAT class this year, I guess. I'm visiting NY (mac expo!) > but are there any microsound type event? > > anyone else on this list going to the mac expo in NYC? cheers, christian ------------------------------ Date: Mon, 02 Jul 2001 17:42:28 -0700 From: cramakrishnan@acm.org Subject: [Slightly OT] OS X Audio Documentation Stumbled across this today and thought it might be of interest to others on the list. Apple has put up more detailed documentation on the OS X audio services: http://developer.apple.com/audio/ Especially interesting is the AudioUnits (from the coreaudio.html page): Imagine you want to build a highly efficient and flexible audio application. The Audio Toolbox offers a solid foundation on which you can build safely--using Audio Units as the basic entity for any kind of signal processing. The Audio Toolbox offers graph services to arrange and group AudioUnits, as well as sequencing and timing services that will give full control over their temporal evolution. - - sekhar - -- C. Ramakrishnan cramakrishnan@acm.org ------------------------------ Date: Tue, 03 Jul 2001 00:00:06 -0500 From: James McCartney <---@---.---> Subject: Re: [Slightly OT] OS X Audio Documentation on 7/2/01 7:42 PM, cramakrishnan@acm.org at cramakrishnan@acm.org wrote: > > Imagine you want to build a highly efficient and flexible audio > application. The Audio Toolbox offers a solid foundation on which you > can build safely--using Audio Units as the basic entity for any kind > of signal processing. To a point. AudioUnits have a lot more overhead than a unit generator in SC/Csound/MSP for example. - --- james mccartney james@audiosynth.com SuperCollider - a real time synthesis programming language for the PowerMac. ------------------------------ Date: Tue, 03 Jul 2001 00:00:06 -0500 From: James McCartney <---@---.---> Subject: Re: [Slightly OT] OS X Audio Documentation on 7/2/01 7:42 PM, cramakrishnan@acm.org at cramakrishnan@acm.org wrote: > > Imagine you want to build a highly efficient and flexible audio > application. The Audio Toolbox offers a solid foundation on which you > can build safely--using Audio Units as the basic entity for any kind > of signal processing. To a point. AudioUnits have a lot more overhead than a unit generator in SC/Csound/MSP for example. - --- james mccartney james@audiosynth.com SuperCollider - a real time synthesis programming language for the PowerMac. ------------------------------ Date: Tue, 03 Jul 2001 15:37:29 +0200 From: Scott Wilson <---@---.---> Subject: Re: Synths within Synths on 7/2/01 6:53 PM, Scott Wilson at sdwilson@mail.wesleyan.edu wrote: > Is there a way of referring to 'child' synths from the enclosing scope? For > instance to tell a group of Spawned Synths to release? > > Scott > > Okay, figured it out. Just add new Synths to an externally declared list and .release as desired. Duh. One question then: I assume the maxVoices instance variable in Spawn is only for Voicer? Thanks, Scott ------------------------------ Date: Tue, 03 Jul 2001 14:43:02 +0100 From: "fabrice mogini" <---@---.---> Subject: Re: About copying code (printing strings) Yes Ben, I finally got it! Thanks for your support (and see you on Saturday!...) Fabrice - ---------- >From: ben <---@---.---> >To: >Subject: Re: About copying code (printing strings) >Date: Tue, Jul 3, 2001, 7:44 am > > er > i knew i should have looked at it again: > > ( > newarray = Array.fill(howManyPbinds, {arg i; Pbind(\freq, freqs.at(i)) }); > > Synth.play({ > Ppar(newarray).asSpawn > )} > ); > > you knew what i meant, right? > b > -- > ben milstein > mintyfresh > www.soundmangle.com - www.elmconceptions.com > >> From: ben <---@---.---> >> Reply-To: sc-users@lists.io.com >> Date: Mon, 02 Jul 2001 23:29:11 -0700 >> To: >> Subject: Re: About copying code (printing strings) >> >> hi >> simpler way perhaps: >> >> ( >> newarray = Array.fill(howManyPbinds, {arg i; Pbind(\freq, freqs.at(i)) }); >> >> Synth.play({ >> newarray = Ppar(newarray).asSpawn >> )} >> ); >> >> cheers! >> ben (in london and loving it ;) >> >> -- >> ben milstein >> mintyfresh >> www.soundmangle.com - www.elmconceptions.com >> >>> From: Julian Rohrhuber <---@---.---> >>> Reply-To: sc-users@lists.io.com >>> Date: Sun, 1 Jul 2001 19:41:03 +0200 >>> To: sc-users@lists.io.com >>> Subject: Re: About copying code (printing strings) >>> >>>> Thank you for answering. >>>> >>>> It is true! it is more logic to copy the Pbind itself but I didn't want to >>>> do that because in that Pbind is a message such as .at(0) >>>> which needs to be increased for each new Pbind of the new array, >>>> so I thought it wouldn't work... >>>> >>>> >>>> If my original is: >>>> Pbind(\freq, freqs.at(0)) >>>> I want to get: >>>> newarray = [ Pbind(\freq, freqs.at(0)), Pbind(\freq, freqs.at(1))]; >>>> when a.size = 2; >>>> >>>> >>>> Could I do this? >>>> newarray = Array.fill(a.size, {arg i; Pbind(\freq, freqs.at(0)) }); >>>> >>>> And then call my different Pbinds like this? >>>> ( >>>> Synth.play({ >>>> newarray.at(0) + newarray.at(1) newarray.at(2); >>>> }) >>>> ) >>>> Fabrice >>>> end >>> >>> >>> I guess you mean this: >>> newarray = Array.fill(a.size, {arg i; Pbind(\freq, freqs.at(i)) }); >>> >>> you have to convert your Pbinds into UGens first, >>> then you can simply mix them: >>> ( >>> Synth.play({ >>> newarray = newarray.collect({ arg item; item.asSpawn(2, >>> event.protoEvent) }); >>> //or for sc3: newarray.collect({ arg item; item.ar(2) }) >>> Mix.ar(newarray) >>> >>> >>> }) >>> ) >>> >> >> > ------------------------------ Date: Tue, 03 Jul 2001 09:58:41 -0400 From: christian adam hresko <---@---.---> Subject: Re: [Slightly OT] OS X Audio Documentation James McCartney wrote: > on 7/2/01 7:42 PM, cramakrishnan@acm.org at cramakrishnan@acm.org wrote: > > > > > Imagine you want to build a highly efficient and flexible audio > > application. The Audio Toolbox offers a solid foundation on which you > > can build safely--using Audio Units as the basic entity for any kind > > of signal processing. > > To a point. AudioUnits have a lot more overhead than a unit generator in > SC/Csound/MSP for example. > > surely this will change in the future. all good people, christian ------------------------------ Date: Tue, 03 Jul 2001 15:49:28 +0100 From: "fabrice mogini" <---@---.---> Subject: Re: About copying code (printing strings) Sorry James, I thought I had understood your example but I realise now that I haven't got an argument duration! Do you mean item (from the array of durations?) From this example, I woud like to get this printed: [ "Pseq([3],1)", "Pseq([5],1)" ]; ( var durations, durationsmemo; durations = [ Pseq([3],1), Pseq([5],1) ]; durationsmemo = durations.collect({arg duration; duration.asString}); durationsmemo.post; ) What is duration? Cheers Fabrice ---------- >From: James McCartney <---@---.---> >To: >Subject: Re: About copying code (printing strings) >Date: Sun, Jul 1, 2001, 7:10 pm > > on 7/1/01 1:05 PM, fabrice mogini at fabrice.mogini@virgin.net wrote: > >> durationsrmemo = Array.fill(durations.size{arg i;"durations.at(i)"}); >> of course the string prints: "durations.at(i)" and not what I want. >> >> How would you do that? > > durationsrmemo = durations.collect({ arg duration; duration.asString }); > > --- james mccartney james@audiosynth.com > SuperCollider - a real time synthesis programming language for the PowerMac. > > > ------------------------------ Date: Tue, 03 Jul 2001 09:49:43 -0600 From: David Cottle <---@---.---> Subject: New editions for DSwSC text Hi, I've reworked the text for our courses, Digital Synthesis using SuperCollider. The examples are more coherent. It still assumes no knowledge of smalltalk or coding. They are available at the swiki: http://swiki.hfbk.uni-hamburg.de:8080/MusicTechnology/19 I'm still working on CAC ------------------------------ Date: Tue, 03 Jul 2001 12:28:03 -0500 From: James McCartney <---@---.---> Subject: Re: [Slightly OT] OS X Audio Documentation on 7/3/01 8:58 AM, christian adam hresko at godpup@ix.netcom.com wrote: >>> >>> Imagine you want to build a highly efficient and flexible audio >>> application. The Audio Toolbox offers a solid foundation on which you >>> can build safely--using Audio Units as the basic entity for any kind >>> of signal processing. >> >> To a point. AudioUnits have a lot more overhead than a unit generator in >> SC/Csound/MSP for example. >> > > surely this will change in the future. No the overhead is inherent in the architecture. SC/Csound/MSP will always be faster than a network built of AudioUnits. - --- james mccartney james@audiosynth.com SuperCollider - a real time synthesis programming language for the PowerMac. ------------------------------ Date: Tue, 03 Jul 2001 11:21:06 -0700 From: cramakrishnan@acm.org Subject: Re: [Slightly OT] OS X Audio Documentation James McCartney writes: > on 7/3/01 8:58 AM, christian adam hresko at godpup@ix.netcom.com wrote: > >> To a point. AudioUnits have a lot more overhead than a unit generator in > >> SC/Csound/MSP for example. > > > > surely this will change in the future. > > No the overhead is inherent in the architecture. > SC/Csound/MSP will always be faster than a network built of AudioUnits. Is this because Apple had a different purpose for the AudioUnits, or is it because they messed up the implementation? - - sekhar - -- C. Ramakrishnan cramakrishnan@acm.org ------------------------------ Date: Tue, 03 Jul 2001 13:28:45 -0500 From: James McCartney <---@---.---> Subject: Re: [Slightly OT] OS X Audio Documentation on 7/3/01 1:21 PM, cramakrishnan@acm.org at cramakrishnan@acm.org wrote: > James McCartney writes: >> on 7/3/01 8:58 AM, christian adam hresko at godpup@ix.netcom.com wrote: >>>> To a point. AudioUnits have a lot more overhead than a unit generator in >>>> SC/Csound/MSP for example. >>> >>> surely this will change in the future. >> >> No the overhead is inherent in the architecture. >> SC/Csound/MSP will always be faster than a network built of AudioUnits. > > Is this because Apple had a different purpose for the AudioUnits, or > is it because they messed up the implementation? I think it is just aimed a a different granularity, like rack units rather than individual ugens. At that level it is a good API. - --- james mccartney james@audiosynth.com SuperCollider - a real time synthesis programming language for the PowerMac. ------------------------------ Date: Tue, 03 Jul 2001 13:35:26 -0500 From: James McCartney <---@---.---> Subject: Re: About copying code (printing strings) on 7/3/01 9:49 AM, fabrice mogini at fabrice.mogini@virgin.net wrote: >> From this example, I woud like to get this printed: > > [ "Pseq([3],1)", "Pseq([5],1)" ]; OK, I thought you only were interested in the duration Patterns' lists. SC does not have a decompiler. I see why you wanted to do some kind of code generation and you could do it that way. However I would probably just do the simple thing write the strings to match each entry. - --- james mccartney james@audiosynth.com SuperCollider - a real time synthesis programming language for the PowerMac. ------------------------------ Date: Tue, 03 Jul 2001 23:26:08 +0200 From: julisn <---@---.---> Subject: MyRibosome MyRibosome,(codename Wolperdinger), first version available on: http://swiki.hfbk.uni-hamburg.de:8080/MusicTechnology/MyRibosome (free, based on SCPlay) It uses standard genetic data files to generate synthesis data for house and dub music. MyRibosome is a software to analyse genetic data and convert it to musical parameters. This application acts like a ribosome in a cell that translates the bases of the incoming RNA into aminoacids that form the components of the folded protein chains. tcattaatcgtccgtggcacaaaaattccattgtcgttggagacacgt tcattaatcgtctgtggcacaaaaattccgttgtcgtgggagacacgt tcattagtcgtctgttgcactaaaattccgttgacgtgcgagacacgt tcattattcgtctgttgcactaaaattccgttgacgtgcgagacacgt tcattattcggctgttgcactaaaattccgttgacgtgcgagactcgt tcattattcggctgttgcactaaaattccgttgacgtgcgaaactcga tcattatttggctgttgcactaagattcagttgacgtgcgaaacgcga ------------------------------ Date: Tue, 3 Jul 2001 23:26:47 +0200 From: Arie van Schutterhoef <---@---.---> Subject: Re: [Slightly OT] OS X Audio Documentation >> on 7/3/01 8:58 AM, christian adam hresko at godpup@ix.netcom.com wrote: >>>>> To a point. AudioUnits have a lot more overhead than a unit generator in >>>>> SC/Csound/MSP for example. >>>> >>>> surely this will change in the future. >>> >>> No the overhead is inherent in the architecture. >>> SC/Csound/MSP will always be faster than a network built of AudioUnits. >> >> Is this because Apple had a different purpose for the AudioUnits, or >> is it because they messed up the implementation? > >I think it is just aimed a a different granularity, like rack units rather >than individual ugens. At that level it is a good API. - -Are these matters a disadvantage in the way you want SC3 in in OS X? AvS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .................................................................. ^ Arie van Schutterhoef | arsche@xs4all.nl ^_北北北北北北北北北北北盻_""""""""""""""""""""""""""""""""" | ` |Schreck Ensemble http://www.xs4all.nl/~schreck/ | ` |# -laboratory for live electro-acoustic music- # | ` |Tel: 00-31-71-5612287 Fax: 00-31-70-3859268 | *========================================================++ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .................................................................. ------------------------------ Date: Tue, 3 Jul 2001 19:43:18 -0500 (CDT) From: jo5_h <---@---.---> Subject: Re: no summer class? mac expo NYC // anyone else on this list going to the mac expo in NYC? i will prolly be there. i've got a pass, so i've just gotta convince my boss to let me go for the day. i just picked up my PowerBook G4 the other day, so it'll be interesting to see what Apple comes out w/ to make it obsolete. ;] obviously i'm not really certain when i'll get to make it to MWNY, but i'd be interested in meeting some ppl from this list if they're going to be there the same day(s). - - jo5_h beep boop muthafuckers http://braineater.net/ ------------------------------ Date: Tue, 03 Jul 2001 20:53:50 -0500 From: r <---@---.---> Subject: Re: no summer class? mac expo NYC > obviously i'm not really certain when i'll get to make it to MWNY, but i'd > be interested in meeting some ppl from this list if they're going to be > there the same day(s). > > - jo5_h let us know where 2 meet. anyone up for a SC street action while at mw? xox r ------------------------------ Date: Wed, 4 Jul 2001 09:42:43 +0200 From: Dror Feiler <---@---.---> Subject: Re: MyRibosome Hi It is interesting idea, but the link you gave does not work. Can you give another link ? Thanks Dror Feiler ------------------------------ Date: Wed, 4 Jul 2001 10:21:40 +0200 From: Maurizio Giri <---@---.---> Subject: Re: New editions for DSwSC text David Cotle Wrote: >They are available at the swiki: > >http://swiki.hfbk.uni-hamburg.de:8080/MusicTechnology/19 > David, I can't find your files in this page. Maurizio ------------------------------ Date: Wed, 4 Jul 2001 10:39:33 +0200 From: Julian Rohrhuber <---@---.---> Subject: swiki problems There is a weird bug in the comanche server for the sc-swiki that we have to fix. Please don't upload anything the next days ... ------------------------------ Date: Wed, 4 Jul 2001 10:39:41 +0200 From: Julian Rohrhuber <---@---.---> Subject: Re: MyRibosome >Hi > >It is interesting idea, but the link you gave does not work. >Can you give another link ? > >Thanks > >Dror Feiler thanks for the hint. http://telenautik.hfbk.uni-hamburg.de/MyRibosome.sit.hqx should always work. We have problems with the swiki at the moment. for links about genetics, try: http://swiki.hfbk.uni-hamburg.de:8080/MusicTechnology/153 ------------------------------ Date: Wed, 4 Jul 2001 10:44:09 +0200 From: Julian Rohrhuber <---@---.---> Subject: Re: New editions for DSwSC text >David Cotle Wrote: > >>They are available at the swiki: >> >>http://swiki.hfbk.uni-hamburg.de:8080/MusicTechnology/19 >> > > >David, I can't find your files in this page. > >Maurizio same problem. It is (probably) still there, but in some backup of the last days. we'll have to move back in time... ( >There is a weird bug in the comanche server for the sc-swiki that we >have to >fix. >Please don't upload anything the next days ... ) ------------------------------ Date: Wed, 04 Jul 2001 06:19:32 -0400 From: christian adam hresko <---@---.---> Subject: Re: no summer class? mac expo NYC > // anyone else on this list going to the mac expo in NYC? > > i will prolly be there. i've got a pass, so i've just gotta convince my > boss to let me go for the day. i just picked up my PowerBook G4 the other > day, so it'll be interesting to see what Apple comes out w/ to make it > obsolete. ;] > > obviously i'm not really certain when i'll get to make it to MWNY, but i'd > be interested in meeting some ppl from this list if they're going to be > there the same day(s). > > - jo5_h > r wrote: > > > obviously i'm not really certain when i'll get to make it to MWNY, but i'd > > be interested in meeting some ppl from this list if they're going to be > > there the same day(s). > > > > - jo5_h > > let us know where 2 meet. > anyone up for a SC street action while at mw? > > xox > r well, i was thinking of meeting up with people. tomonori will be there, so that will make a whopping four of us. i still haven't bought my outrageously priced ticket, but i'm planning on going. there's a few other native NYC list members, so maybe they would be interested in meeting up as well? i'm gonna bring my titanium along as well, and HOPE that apple doesn't release a faster model at the same price therefore depreciating the value of my computer in the blink of an eye. (but i'm sure this will happen...) cheers, christian ------------------------------ Date: Wed, 04 Jul 2001 06:28:35 -0400 From: christian adam hresko <---@---.---> Subject: [OT] Fourier and Compiler settings hey wow cool. got my first C++ (ported from some fortran) fourier transform to produce correct values. it's not 'magic' after all. one problem though. when using larger values (like an array of 10,000 floating points) i get a "local values > 32 K" compiler error. anyone know how to resolve this? i thought changing the heap size would work, but that didn't do anything. thanks. christian ------------------------------ Date: Wed, 04 Jul 2001 13:09:08 +0100 From: "fabrice mogini" <---@---.---> Subject: About the SC users-digest I had a look at the list of mail archives on the Supercollider website (SC users-digest). I have downloaded some but am unable to read them because my computer doesn't find in which application these files were created. Do you know which translator I need to use? Thanks Fabrice ------------------------------ Date: Wed, 4 Jul 2001 14:45:01 +0200 From: Maurizio Giri <---@---.---> Subject: Re: About the SC users-digest >I had a look at the list of mail archives on the >Supercollider website (SC users-digest). >I have downloaded some but am unable to read them because my >computer doesn't find in which application these files were created. >Do you know which translator I need to use? >Thanks > Fabrice They are plain text files, you can open them with any text editor or word processor (not with SimpleText though because they are generally "too big" i.e. more than 32 K!) bye Maurizio ------------------------------ Date: Wed, 04 Jul 2001 22:38:11 +1000 From: newton armstrong <---@---.---> Subject: Re: About the SC users-digest fabrice mogini wrote: > I had a look at the list of mail archives on the > Supercollider website (SC users-digest). > I have downloaded some but am unable to read them because my > computer doesn't find in which application these files were created. > Do you know which translator I need to use? > Thanks > Fabrice > just launch BBEdit or SimpleText and open them from within the application. i use BBEdit because it's got grep-powered searching built-in. this has saved me from asking any number of stupid questions on the list. ------------------------------ Date: Wed, 04 Jul 2001 13:56:23 +0100 From: LUThER_SKIZZO <---@---.---> Subject: Re: About the SC users-digest on 4/7/01 1:09 pm GMT, fabrice mogini at fabrice.mogini@virgin.net apparently typed: > I had a look at the list of mail archives on the > Supercollider website (SC users-digest). > I have downloaded some but am unable to read them because my > computer doesn't find in which application these files were created. > Do you know which translator I need to use? > Thanks > Fabrice Hi BBEdit or BBEdit lite [free]: - -- LUThER ------------------------------ Date: Wed, 04 Jul 2001 08:54:39 -0500 From: James McCartney <---@---.---> Subject: Re: [OT] Fourier and Compiler settings on 7/4/01 5:28 AM, christian adam hresko at godpup@ix.netcom.com wrote: > one problem though. when using larger values (like an array of 10,000 > floating points) i get a "local values > 32 K" compiler error. anyone > know how to resolve this? i thought changing the heap size would work, > but that didn't do anything. malloc the array. You can't have a function with more than 32K of local data, because the immediate offset is 16 bits in a PPC lwz instruction word. - --- james mccartney ------------------------------ Date: Wed, 04 Jul 2001 18:38:10 +0200 From: julisn <---@---.---> Subject: sc-swiki online again We have solved the problem. in future for info, you can use : http://swiki.hfbk.uni-hamburg.de which is our apache that forwards to swiki. ------------------------------ Date: Thu, 05 Jul 2001 01:26:29 +0200 From: heiko goelzer <---@---.---> Subject: PlayBankLoop.sc > This message is in MIME format. Since your mail reader does not understand this format, some or all of this message may not be legible. - --B_3077141190_1290649 Content-type: text/plain; charset="US-ASCII" Content-transfer-encoding: 7bit Hi ben, here is my first approach on working with your PlayBankLoop.sc. its really useful and makes a lot of fun. i attached the two classes i changed for everybody else to try. you have to have julians SampleBank.sc on. then you can play samples, cut them in small chunks and recombine. makes sence for rythmic sounds as well as for anything else. all the best heiko - --B_3077141190_1290649 Content-type: application/octet-stream; name="ben.sit"; x-mac-creator="53495421"; x-mac-type="53495435" Content-disposition: attachment Content-transfer-encoding: base64 U3R1ZmZJdCAoYykxOTk3LTE5OTggQWxhZGRpbiBTeXN0ZW1zLCBJbmMuLCBodHRwOi8vd3d3 LmFsYWRkaW5zeXMuY29tL1N0dWZmSXQvDQoaAAUQAAANgAAAAHIAAQAAAHJneg2lpVJlc2Vy dmVkpaUApaWlpQEAADMAQLdpZHC3aWmiAAAAAAAAAAAAAAAAAAN99gAAAMkAACYrAAAMtwAD YmVuAAAPuQAvAA0BCQGhAQABPAKQAU7////5w0AAAIAAAAAAAAAApaWlpQEAADwAELdpaaK3 aWuWAAAAcgAACHoAAAByAAxkKAAADjIAAAUPAAAAAA8AbXVsdGlfbG9vcGVyAAGhoFRFWFRT Q2ptAQAAAAABAAAAAAAAAAAAAIAAAAAAAAAAAAAQFAAAAjQAAAAADwBCwdTzGOCC5sbbI6f/ znUxTNFGyMmINFfghWeo+NRzuxLnaDqPaif9/UybCcgbkNkcxDadwcJSRKMXDzMj5h0pJElr NMUFLJTUcDeV6FJv9NENwCf1hmpn6V63DYfITUZ1a2up2KHICKrRJyXI21Ot+Z7N1isfRngn Yfw3kKf4K7H6wkR77Xg44Y2Zr2CUW//RxX6uuosQub2+6/JN7JjQcZzAuavRaqwKF2xY0rAl TTQwNqYQRrg8yFOyzXyoCoVgedqfr0R5GbzDjUUQWp8zySsYsE1abKQ0Q/5MRT8XpRIX7vji GL6YvfOyUujxyT/oFxNxFHrSmgh8kL4DCmNmg3Oj3r+6DdbEmsqdf/gulgZyxxyRP9OpIC3Z 9HIUv0WQ7R4/e8Oymu/kczP5vnh9cPA+HT0L75iz+GwCpUWcgMN53Mm2uaTQPpOKKy2h6/u8 o74DIs2J44zg2nBuQYgmZfkENo9Fy4GL6c/4YwQKvGGbp9vHAKMk2NEimeH7mG6PEAWi2Dv+ a7mGWQA+mQBc5fjqSEW61dmrv9FbmSZ1wBeOhXInDMvUVMhZMYJEDY6pqFo/4T/RJJ2ku/wy Cugn6Hsx64+0x5qZSLxbeiNoi7jGaJzSzA4CoW/nHmYydj8lTO1ClbYLrx6WrbQIhwNOfoDC IYK8WpNU6COYtRAAT03/E7B82DEI7tct56M0uPZy8Uw5m8mduyHxDGFC6+k5PjKChdV+PxXw pgKlI+dSrnpUkuhCwdSMzQ7Gs38OC66ZbbTDFYNYHvKB2euvirFguaqIkcxUWDaGG3LJKRNC RmBHB1IWNigVTXq7BDzvoBJznkLVzyEHMc3fi3n3nqPIGI0oeX+AVdtO1EbxZ4bBhclaPzNY YnLXdmobwrka+xTi9S/TXDN/eFnpqVEKchh5qwE/JNbMlrro7NHCecUSXZlNtA98uozmLNA9 mJe8ysrB6gW+Ui3LCiUXRcTUMu6GxffBNoPGrJb94x2t+PrV8SYPjcqZTSlW3N//gmRnyRQA DTQkEm85MG0o/OqBfUkIICiMEheNFgG+DkP7661ttJkNhozzG3VSsSINLbRy9MJmRpqMyQ1n VqA6NXTjo59cDZhVTUlCc7PSz2t9Wxh37Zo55pLJBO2l93U3MQOkplwfNno7AsfWUnelH8Qc O2Trq/+3Qj3q3jbPYGAgMnPUdXoLhgdXdkjXDsQA5e61A/8cE/09ZC3p7E/3/yC0dBShkNyT fFEokFvjrgNEKZGHp7uRFZZYO9ht46FsNxkotD8L0jC2lDQJ8JcI7XzT8ZzKP+YkwxGcTkiX yWlhT1a62R6qxTTe6m5SgzQYmQFejQsNT/FfQaFpjcEUGciLRVtnadbnqeKoeQthnkuK+N7H +XObX4lT8kI8xH6TtqjRoe9pqP0BvoNlBujG4A93DHUDWaCi1//EHLIi214644hqujCVyHYH 3y1ha1bD8EHJMOoJm7nc3Wz00Yl1w/q9UE6Q+Zk4vQP7W0vAcLl2+sIAjnoiQYBp6VUFGFcS JBWvMs4sKYySH8FGngFWWDM0CXPPgOaex4FmTcKoTEzxoRgIZIR5F8/vSWncicgBpELy3fD4 Jfwrg2OEGsrl+2IQfGog28eKq4+GEGnWQomVe768qgj+E5HHHVzAAYM5B+13VSUugREaHBes OEz1OeUH6aFm4JPAlR20WO3yT1ueH4QB3H8G2KA/IH8wmNWoU1gtrOa6dNTLfJA141yuWEY5 vuRXGGRqbQa4IhIc18Uq+Y0l0gP9CYRNTWMkOa3u17gJX5UuY7e18ajWRH/PRSnJqVlTibbl jlinbNWHV7qeHgixbgHt2z9IL60j0jQvPLM+kGOTkBUExNWOpSbHZ3Hr+zQytPYsDJhiLjcP 7FndrNLQcuocDff+ozjssY8wP+xKQA0l9rPlHp4SewAwFDx9cDtxV909ylNA5HtILWvjYCUf bl63OUc0Qd/czvHA+kaJOhVFG/84C9ir39Qc99PeG37J6bZpKiz4rEEeirm5oSJB80NpbWeh u3Wg96nsYByY595gNnoqEI8GV7U0i/waKIF5WR8i2+ZuHwkIcwLnAIslYhqeD1x/ErD6bcln wCQwZCHzUQDhLWO1WGy8ZK88HuP7NskaoHEctFEQVa80CoueC6rEVCC+2JXCpny4spyQsPbG 7UzBgUEibH77sn2DFA4Sf6v86GEk8LR2eJCbr+ZYYv0FIlmsUhC9wDfTbntXtutLEVXwkDim q7m5TIsEnTRVxb7wM/ghZXQWLtXazV82CT21/DIId4j/+4eLqHsFzoJ2IO9gDCag7h722AMf 0v9T12euO0FC2cGx6UXAl3QhTdZNAmv9uKi6PITEWWw6CKljtT0c3MnY/C99z01QFyhya7fw l8hdW6Mdge7XZYqEMWwTxA17iUSHYQWD53mUQoVZLEprj1CydlNiSzLlvwyDn9gbPbEGMitA /NgaBmaPMB04gKWlpaUBAAA/ABC3aWRzt2lkcwAAAMkAAAsfAAAAcgAPOg0AAAHzAAABCwAA AAAPAFBsYXlCYW5rTG9vcC5zYwABHzhURVhUU0NqbQEAABgAAQAAAAAAAAAAAACAAAAAAAAA AAAAAmgAAAEpAAAAAA8AQsHVGS/XHa5GLshX59Xaqg6ui/JEngH5R1W+aKxErbQpQY0Ufxq7 +A0FIgA3OxNQHy9mXJ4sB87VI3M/s3YxeW6uj5VOL3iAgZDc7kez/qUP7VkXwlRnreMzId1h Y3KPHORlwiv8vCJC63XE5BDUTxqDxbc99RFz9kygL3CXJV2vnu3Yt9pvojfT/fZRX5K047N+ rvsdfdzUXHqbh6F0HGhH8pOlZ7xrkBgCpM37qPjipfbh4Tr1RqA0/rA1rOIEGyDilFPiHE/p U3L7p4EvIv5fXMoTWUdTRURFZrzlxaykef0psU8fTnjYTGYh1n20oJq33b8ipF4PlvZydkq+ xRAFOMq8eVioZoREbZh05MiLeNIgTwv3vHaD6FLkWVa+o3YWkxZBv/kAQsHUtY5BzlN6Cbze vrCcsXbUy1aJ/NKqZTXXRnTWHjhOTQj/VvTX11BHu5Vzi2I7KKbjp75gCt7UbEjyEYM2f5oE wpj/1mirzZVJgS6xkgRd7x15fY2aDz5P1BOy78t2YDHXKqEpgxO/drK0G6ef6aNOomPYw7b7 3BA35o5ZrA8pE8WvJGQ9PWGHYh2Kzp5E1NeuzzOtqEpfB6DQ0XQf1fj+zsTugMmOZXCvMtqM w/gBb53xjXlVT+FKzO0mTF+PltbiglYPKyD6RvFNp7x/ejmd77/LcY+tHYpbqAwNQQEjI3su oy1u8M3McSRC4yKqrj074aaO1Nd57zxrDGY01+CThGweJoSvK1AApaWlpQEAAD8AELdpZRq3 aWUaAAAIegAADVAAAAByAA+AKgAAAUoAAADNAAAAAA8AUGxheUp1c3RMb29wLnNjAAG6y1RF WFRTQ2ptAQAAMAABAAAAAAAAAAAAAIAAAAAAAAAAAAACQAAAAPMAAAAADwBCwdSE8IqXHoBt oEg5OovxHUJZmjr1l/O5Vdwd+lB/V9DUqUJnKH5rritrALGkZ2dKjx+EsjAexM89atDu07hu r3woRqZQKbJ9bTNaP9bIlbxVX7mmlgC+1/IWaJ2kM8dOZPm4mTQ1JRWTw57VgMaWaWG3UJ6K Ti7mHjvDyFx/BsvwrnarpkLm0dxrpmDhHGBC9LqsonMGsKCCguEkDNyma1Uk5Rs2nnpeD+IO 0ksMno1YFrg/Lv9i2CT8mDngIU4wdj5f0F4xtElOgrmkCSWReq6JbghXkC8z9yFjT7koLLuC VbUfR3cgPAA4qO7ML7RpRgBCwdSasANduejM/lk3txOl5R0Qy8jwZMc6liObWij7XrKFvuxI 7eK6l2jvz/+iyDW0JYw1uPuPAoS2vs05wD7aM2gI/VWenshtZKRcXwkgCtDs2phLy9lRyJx0 Fh5SOIVjlO5BLeIcHHL9p82mWamP+a7Yc4mLWBm0r4TmMj405slvT4WwJoJXvPE/Nr4m961t Q6V4GdOg5aRDNPK9+sR4HhWLcEcUlGHIr/vodfkTsV+0gnWYJe5TXnq3JhkwR3W4Af8FAP2E tigGIBAApaWlpQEAADAAQAAAAAAAAAAAAAALHwAAAAAAAAByAACO/P////8AAAAAAAAAAAAA - --B_3077141190_1290649-- ------------------------------ End of sc-users-digest V1 #316 ******************************